NucleaRDB: Extraction of mutation data from the literature

This data was extracted from Medline abstracts and full texts (when available) in an automated manner.

The table below describes the selected point mutation and provides links to other documents. The sentence(s) where the point mutation G6P was found are listed after the table.

The mutated residues are also indicated in the family sequence alignments and hyperlinked to the corresponding mutation pages.

Point mutation G6P in PPAT_HUMAN

Relevant sentences:

G6P

• ------------------------------------------------------------------------ It has recently been shown that adenoviral-mediated expression of peroxisome proliferator-activated receptor g co-activator-1a (PGC- 1 a) in hepatocytes sti mulates glucose-6-phosphatase catalytic subunit (G6Pase) gene expression

• A combination of fusion gene , gel retardation and chromatin im munoprecipitation assays revealed that , in H4IIE cells , PGC-1a mediates this sti mulation through an evolutionarily conserved region of the G6Pase promoter that binds hepatocyte nuclear factor-4a

• Mutations that inactivate the glucose-6-phosphatase catalytic subunit (G6Pase) give rise to glycogen storage disease type 1a [ 3 ] , whereas overexpression of G6Pase is thought to contribute to the increased hepatic glucose production characteristic of both type I and type II diabetes [ 4 ]

• In liver , expression of both PGC-1a and PGC-1b are markedly induced by fasting [ 9 ] , and adenoviral-mediated expression of PGC-1a in primary hepatocytes induces G6Pase and phosphoenolpyruvate carboxykinase (PEPCK) gene expression , as well as glucose production [ 7 ]

• In the present study , we describe the use of a combination of fusion gene , gel retardation and chromatin im munoprecipitation assays to identify hepatocyte nuclear factor-4 a (HNF-4a) as the transcription factor that mediates the induction of mouse G6Pase gene expression by PGC-1a in H4IIE cells

• Plasmids The generation of mouse G6Pase-chloramphenicol acetyltransferase fusion genes , containing promoter sequence located between -484 / +66 , -271 / +66 and -158 / +66 , relative to the transcription start site , has been previously described [ 11 ]

• Additional G6Pase promoter fragments containing sequence between -297 / +66 , -85 / +66 and -35 / +66 were generated using restriction enzyme digestion or PCR and were also cloned into the pGL3 MOD vector

• Oligonucleotides representing the sense and antisense wild-type G6Pase promoter sequence between -82 and -47 (see Figure 2 A) were synthesized with BamHI compatible ends and subsequently gel purified , annealed , and labelled with [a-32P]ATP using the Klenow fragment of Escherichia coli DNA Polymerase I to a specific activity of approx. 2.5µCi / pmol [ 17 ]

• PCR primers were designed to amplify the G6Pase promoter [5´-(-162) CGTAAATCACCCTGAACATGTTTGCATCAACC (-131)-3´ and 5´-(-17) CCTTGCCCATTTTATATGCCCTGGATTC (-44)-3´] and exon 5 [5´-(+723) GTTTGGTTTCGCACTTGGAT (+742)-3´ and 5´-(+940) GCAGTTCTCCTTTGCAGCTC (+921)-3´]

• RESULTS Deletion of the mouse G6Pase promoter sequence between -85 and -36 abolishes the sti mulatory effect of PGC-1a on basal G6Pase fusion gene expression Spiegelman and co-workers have shown that adenoviral-mediated expression of PGC-1a in primary hepatocytes induces G6Pase gene expression [ 7 ]

• To identify the G6Pase promoter region that mediates the sti mulatory effect of PGC-1a on basal G6Pase gene expression , H4IIE cells were co-transfected with various 5´ truncated G6Pase-luciferase fusion genes and either a control expression vector or the same vector encoding PGC-1a

• Similar to results previously reported using HepG2 cells [ 11 ] , basal G6Pase fusion gene expression in H4IIE cells decreased markedly when the promoter region between -484 and -272 was deleted but , in contrast to HepG2 cells [ 22 ] , further deletion of the region located between -271 and -36 resulted in minimal change ( Figure 1 A)

• The induction of G6Pase fusion gene expression by PGC-1a , expressed as percent of maximal induction ( Figure 1 B) or fold induction ( Figure 1 C) , decreased when the promoter region located between -484 and -298 was deleted

• In contrast , the induction of G6Pase fusion gene expression by PGC-1a was abolished when the promoter region located between -85 and -36 was deleted ( Figures 1 B and 1 C) , but this deletion was associated with only a minor change in basal promoter activity ( Figure 1 A)

• This result suggests that the induction of G6Pase fusion gene expression by PGC-1a requires an element located between -85 and -36

• Mutation of an HNF-4 and PPAR / RXR binding site in the G6Pase promoter abolishes the sti mulatory effect of PGC-1a on basal G6Pase fusion gene expression Examination of the residues between -85 and -36 revealed a potential binding site , located between -76 and -64 , for HNF-4 and the PPAR / RXR heterodimer ( Figure 2 A)

• This binding site is conserved in the equivalent location within both the human and rat G6Pase promoters [ 23 , 24 ] and PGC-1a has previously been shown to interact with PPARa , PPARg and HNF-4 [ 5-7 , 25 ]

• To assess the role of this HNF-4 / PPAR / RXR binding site in mediating the sti mulatory effect of PGC-1a on G6Pase fusion gene expression , this element was mutated by site-directed mutagenesis within the context of the -85 to +66 G6Pase promoter fragment ( Figure 2 A)

• Mutation of this HNF-4 / PPAR / RXR motif abolished the sti mulation of G6Pase-luciferase fusion gene expression by PGC-1a ( Figure 2 B)

• The effect of this mutation was equivalent to that seen when the entire -85 to -36 promoter region was deleted , as is the case with the -35 G6Pase-luciferase fusion gene ( Figure 2 B)

• This suggests that HNF-4 and / or PPAR / RXR may be the factors that are mediating the sti mulatory effect of PGC-1a on G6Pase-luciferase fusion gene expression through this promoter region

• HNF-4a and PPARg / RXRa bind to the G6Pase promoter in vitro To provide evidence that HNF-4 and / or PPAR / RXR are indeed the factors that are mediating the sti mulatory action of PGC-1a on G6Pase fusion gene expression , protein binding to the -82 to -47 G6Pase promoter region was analysed using the gel retardation assay

• When a labelled double-stranded oligonucleotide , designated G6P WT , representing this sequence was incubated with nuclear extract prepared from H4IIE cells , a single major protein-DNA complex was detected ( Figure 3 A)

• The G6P WT oligonucleotide competed effectively for formation of the protein-DNA complex ( Figure 3 A)

• By contrast , an oligonucleotide , designated G6P MUT , that contains a mutation identical to that described in the -85 HNF-4 SDM construct ( Figure 2 B) failed to compete with the labelled probe for protein binding ( Figure 3 A)

• However , the possibility that either PPARa or PPARg could also mediate the action of PGC-1 on G6Pase gene expression in vivo cannot be dismissed

• To determine whether PPARg / RXRa heterodimers can bind the -82 to -47 G6Pase promoter region , these proteins were generated using an in vitro reticulocyte lysate expression system and protein binding was analysed using the gel retardation assay

• When the labelled G6P WT oligonucleotide representing this sequence was incubated with unprogrammed lysate , or lysate programmed with PPARg or RXRa individually , no protein-DNA complex was detected ( Figure 3 C)

• In contrast , when the labelled G6P WT probe was incubated with lysate programmed with both PPARg and RXRa together , a single protein-DNA complex was detected ( Figure 3 C)

• Thus , the combination of these protein binding experiments and the functional data shown in Figure 2 (B) are consistent with the hypothesis that , in H4IIE cells , HNF-4a mediates the sti mulatory action of PGC-1a on G6Pase gene expression

• HNF-4a binds to the G6Pase promoter in situ ChIP assays [ 20 , 29 ] were performed to assess HNF-4a binding to the G6Pase promoter within intact cells

• Fragmented chromatin from formaldehyde cross-linked H4IIE cells was subjected to im munoprecipitation with HNF-4 antiserum , or with IgG as a control , and the presence of the G6Pase promoter in the im munoprecipitates was then analysed by PCR using primers that recognize the G6Pase gene sequence between -162 and -17

• As can be seen from Figure 4 (A) , the G6Pase promoter was enriched in the HNF-4-im munoprecipitate compared with the IgG control

• To test the specificity of this antibody-protein interaction , these im munoprecipitates were also analysed for the presence of exon 5 of the rat G6Pase gene [ 24 ] using PCR primers that recognize the G6Pase gene sequence between +723 and +940

• As expected , no enrichment of G6Pase exon 5 was detected in the HNF-4-im munoprecipitate compared with the IgG control ( Figure 4 B)

• These results suggest that HNF-4a binds to the G6Pase promoter inside intact cells

• DISCUSSION Adenoviral-mediated expression of PGC-1a in primary hepatocytes sti mulates G6Pase gene expression [ 7 ]

• A combination of fusion gene ( Figures 1 and 2 ) , gel retardation ( Figure 3 ) and ChIP assays ( Figure 4 ) suggest that , in H4IIE cells , PGC-1a mediates this sti mulation through an evolutionarily conserved region of the G6Pase promoter , located between -76 and - 64 in the mouse gene , that binds HNF-4a

• However , since both PPARg and PPARa are expressed in liver in vivo [ 30 ] , the possibility exists that both of these factors , in addition to HNF-4a , may be important for the induction of G6Pase expression by PGC-1 a in vivo

• Future studies examining the effect of PGC-1 on G6Pase gene expression in mice containing liver-selective deletions of the genes encoding PPAR a , PPARg or HNF-4a should be able to address this issue

• Moreover , there are several genes , such as G6Pase ( Figures 1-4 and [ 42 , 43 ]) , whose expression are regulated by both factors and it would have been predicted that the hepatic expression of such genes should have been significantly affected in MODY1 and MODY3

• Whole site ...Author ...Keywords ...Title (image) (image)Immediate publications (image)Current issue (image)Browse archive (image)Search archive (image)Commentaries (image)Reviews (image)Online submission (image) (image) (image)News (image)Table of contents by email (image) (image) (image)Abstract (image)PDF file (image) (image) (image) (image) Figure 1 A G6Pase promoter element located in the region between -85 and -35 mediates the response to PGC-1a (image) Figure 2 Mutation of the G6Pase promoter region between -76 and -64 abolishes the response to PGC-1a (image) Figure 3 HNF-4a and PPARg / RXRa bind the G6Pase promoter region between -82 and -47 in vitro (image) Figure 4 The G6Pase promoter binds HNF-4a in situ (image) (image) (image) (image) (image) (image) (image) (image) (image)

F.Horn (nucleardbcmbi.kun.nl), 21-Apr-2005